BIOL 114
Biology Dept
Kenyon College
Chapter 2.
Mendel, X-Linkage, and Pedigrees
Fall SectionSpring Section 1Spring Section 2
 
  • Mendelian inheritance
  • Alleles: What are they? 
  • Sex determination
  • X-linked traits
  • Pedigree analysis 
  • Assumptions of Mendelian Inheritance
    • Constant environment (temperature, nutrition, sunlight etc.)
    • Traits only influenced by known gene loci
    • Genes assort independently -- zero "linkage"

    Mendelian inheritance
    Use Flowers tutorial: p:\data\biology\biol14\tutorial\flowers.exe

    Know these terms:

    • Gene Locus
    • Gene Product
    • Allele
    • Dominant and Recessive alleles; Null alleles
    • Trait
    • Genotype
    • Phenotype
    • Hybrid: Monohybrid; Dihybrid -- Dihybrid Cross
    • Self cross
    • Test cross or Back cross (when are these the same -- and when not?)
    • Probability rules
    Problems:
    Mendelian Genetics Practice from a course at MIT.

    Other links:
    Mendel's Peacocks
    Horse Genetics: describes interesting horse phenotypes and genotypes, crosses and results
    Online Mendelian Inheritance in Man: a professional physician’s reference on inherited diseases



    Alleles:  What are they?

    An allele is a particular version of a given DNA sequence.  "Allele" is a relative term, implying more than one possible version or copy, like different editions of a book.  Like editions of a book, all existing alleles result from a process of change, either gradual or drastic change.

    Examples:

    Allele 1
            ATCGTTAGATTACAGATTTACCGA
            TAGCAATCTAATGTCTAAATCCGT

    Allele 2
            ATCGTTAGATTCCAGATTTACCGA
            TAGCAATCTAAGGTCTAAATCCGT

    Allele 3
            ATCGTTAGTGTAATGATTTACCGA
            TAGCAATCACATTACTAAATCCGT

    Allele 4
            ATCGTTAG-GATTTACCGA
            TAGCAATC-CTAAATCCGT

    Notice that there can be more than two possible alleles for a given gene locus (but only two at a time, in a given diploid individual.)
    Multiple alleles can mean  many different possible combinations for individuals.  An example of multiple alleles is human blood type -- A or B alleles encode a blood serum protein, whereas the O allele makes no protein ( a null allele.)  Gene loci which confer traits of tissue type may have 20 or more different alleles.

    Natural and "artificial" alleles

    • Natural alleles result from evolution, the process of natural selection.
    • Artificial alleles can be created by molecular genetics.
    • Both natural and artificial alleles can be used by the scientist for breeding purposes.


    Alleles can be observed as DNA polymorphisms, using restriction digest and gel electrophoresis (see Week 7).
    An allele may be linked to an inherited disease--a clue as to the gene locus defective in the disease.
    Which of the  four alleles (M1-M4) is linked to this disease?
    Is the disease likely to be dominant or recessive?

    For a Kenyon student's report on an inherited disease in her family, see Tuberous Sclerosis Complex.



    Alleles confer traits, by expressing gene products, which are either mRNA and protein, or a functional RNA.   But how they determine a "visible trait"  is not simple.  Consider this:

    Problem:

    Fruit fly eyes have two pigments, brown and scarlet.  Normal flies make
    both pigments, but a strain with defective gene B has brown eyes, and a
    strain with defective gene S has scarlet eyes.
    In the wild type, WHICH GENE (B or S) makes which pigment (brown or scarlet)?Solution

    In practice, the most common "new" alleles (arising out of mutation) are often named for a phenotype resulting from the absence of their gene product.  Thus the allele for a gene producing scarlet pigment is named "brown" for the brown eye in the absence of scarlet pigment.

    Consider albinism, or loss of pigmentation, a very common phenotype observed in many species of animals and plants.  Alleles can confer loss of pigmentation in two different ways:
     

    • Recessive albinism.  The allele encodes an enzyme which converts pigment precursors into dark pigment; or a protein required for pigment deposition.  (Humans; mice; penguins.)
    • Dominant color suppression.  The allele encodes a regulatory protein which represses synthesis or deposition of pigment.  (Horse; foxglove)
    Traits are not actually inherited like "beads on a string." Traits result from complex interactions (1) among the products of genes; (2) between genes and regulatory proteins expressed by other genes; (3) between genes and proteins, and environmental factors such as nutrients, temperature, etc.; (4) chance effects during development.

    The reason Mendelian inheritance can be seen to "work" is that in many cases we can hold all the above factors constant, for a given genotype (genes affecting a trait) and a given phenotype (appearance of trait).



    Other ways alleles can work (still at a SINGLE gene locus)
    • Codominance or incomplete dominance.  Codominant alleles each contribute to the phenotype; for example A and B blood type alleles together produce AB blood type.   Incomplete dominance means that the hybrid produces a lesser degree of the dominant phenotype than the purebreeding dominant.
    • Lethality.  If an allele (either dominant or recessive) results in death before birth, a class of progeny will be absent from the offspring.  What ratios will result?

    • Pleiotropy. One allele (or pair of recessive alleles) at one gene locus can result in many diverse effects throughout the body.
    Artificial alleles. Today we can use molecular genetics to create artificial alleles in transgenic animals and plants.  There are two ways to make a transgene, which have  different consequences for inheritance:
    • Allele insertion.  Inject or transfect DNA into a fertilized egg.  The DNA sequence gets taken up somewhere in the genome, but not at the same position as any homologous gene.  The position on the gene map is unpredictable (but fixed once the allele is inserted.)
    • Allele replacement.  A DNA sequence containing a linked selective marker (such as drug resistance) is put into embryonic stem cell culture (ES cells).  The ES cells are put into a blastula, which develops into a chimeric offspring; eventually a pure-breeding line is bred.  In this case, the new allele recombines homologously and replaces an allele at a standard map position.


    Dihybrid Cross


    Advanced Problem.  Explain how to breed transgenic mice to create a mouse model for sickle-cell anemia.
    Sickle Cell Anemia.

     Pászty et al, Science 1997 October 31; 278: 876-878.

    Sickle-cell disease is caused by a single base pair defect in human beta-globin.

    • Double-recessive genotype--red blood cells sickel under stress.
    • Single-recessive heterozygote--cells sickle only when attacked by malaria parasites.  Prevents malaria.
    To test drug therapies for sickle disease, can we generate a transgenic mouse model for human sickle-cell anemia?

    For the model strain to exhibit sickle-cell pathology, the native mouse genes--all at separate loci--must be defective (null alleles.)  We have a transgenic mouse strain, containing human Hb-alpha, Hb-beta-sickle on a transgene,Tg(Hu), inserted somewhere in the mouse genome (not at the mouse globin genes.)  But the mouse still has its own genes producingalpha  and beta globin.

    To construct this strain, the transgenic strain was intercrossed with a mouse strain heterozygous for null alleles for  alpha and beta globin.

     Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb
     --------     ----------------------       ----------------------
     Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb

                                X

        --         Mouse-alpha-Hb     Mouse-beta-Hb
     --------     --------------------       --------------------
        --            ----                            ----
     

    How many generations would you need to cross?
    What proportion of mice would show the desired phenotype of blood with entirely human globins?
     

     Tg(Hu)               ----                         ----
     ------------     ------------------     -------------------
     Tg(Hu)        ----                         ----

    What would the researchers have to do to create a similar model with exclusively normal human blood?  Why would this be important in order to use the model?  (For further interest, read Ryan et al, 1997.)


    Sex determination

    What is the function of sex?  Why have so many animal and plant species evolved the complex mechanisms of sexual recombination?

    Natural selection favors diverse combinations of traits, because when the environment changes,  there is greater chance that some individuals will survive.

    How do animals and plants develop two different sexual types (sexes)? Different species do it differently:

    • Male and female organs develop on the same individual.  (Garden pea plant; invertebrate worms)
    • Juvenile is born female, later develops into male; or vice versa.  (Some fish and other vertebrates)
    • Diploid (female) versus haploid, from unfertilized eggs (male)  (Ants, bees, other social insect colonies)
    • Sex chromosomes--X, Y (mammals) or W, Z (birds; moths).  One member of pair (male Y, or female W) is largely degenerate, having lost most of its genes through evolution.  (Why?)
    Read the latest about evolution of X and Y.


    X-linked inheritance

    Species that show X, Y sex determination can have two different mechanisms of addressing gene dosage:

    • Random inactivation of one X or the other, in early embryonic cells.  (Humans)
    • Half down-regulation of gene expression from both X chromosomes.  (Drosophila)
    In either case, traits encoded by genes on the X chromosome will show X-linked inheritance.  A female carrying two recessive X-linked alleles, when crossed with a wild-type male will produce criss-cross inheritance.  This is because the Y chromosomes from the male all behave as null alleles (Why?).  So the recessive allele from the female parent is always expressed in the male offspring.  But her female offspring will receive one wild-type allele from the father.
    The other, normally paired chromosomes are called autosomes.

    For  X-linkage, you need to know the results of these crosses:

              A   A              a
            X   X   with  X    Y   ---->  offspring?

              a   a              A
            X   X   with  X    Y   ---->  offspring?

              A   a              a
            X   X   with  X    Y   ---->  offspring?

              A   a             A
            X   X   with  X    Y   ---->  offspring?

    You also need to FIGURE OUT THE PARENTS of a given combination of offspring.

    X-linked traits

    X-linked traits are particularly common because they only need one recessive allele present for the phenotype to be expressed in the male.  Some examples:

    • Colorblindness. About a third of all men  are partly  color-blind.  Defective alleles are so common because (a) their effect is non-lethal, and (b) the genes for red and green photoreceptors are extremely similar and lie close together on the X chromosome, where they can recombine (cross over) with each other by mistake.  Sometimes a color-blind person can see a different "hybrid" color that no one else can!
    • Duchenne Muscular Dystrophy
    One of the interesting features of Fragile X syndrome is the role of imprinting by methylated genes. (See next week.)




    Pedigree analysis
     

    Autosomal Recessive. 
    Trait appears only when two parents by chance carry the hidden allele.


    X-linked Recessive.
    Mother passes on to half  of sons;
    half of daughters carry it.  Father never passes on trait.


    Autosomal Dominant.
    Trait appears in every generation, in about half of descendants (assuming a heterozygous carrier.)

    X-linked Dominant. 
    Father passes trait to all daughters; no sons.  Mother passes on to half of children.



    Problems: More Pedigrees, here ;  SOLUTIONS; Still more pedigrees **Medical Pedigrees


    To understand "dominant" and "recessive":
    • A Dominant gene makes MUCH MORE than enough protein to cause a trait.So only one is needed; perhaps only in some cells.
    • An Incompletely Dominant gene makes BARELY ENOUGH protein for the trait.  So TWO COPIES are needed for the FULL trait.
    • A Recessive gene makes no protein; inactive or partly active protein; or not enough protein for the trait.

    Partial Penetrance and Variable Expressivity

    In real pedigrees of real people, inheritance of any trait (dominant or recessive) is often confounded by partial penetrance or by variable expressivity of a trait.

    • Penetrance is the percentage of individuals with a genotype who actually show the trait.  If only 80% of people with the genotype actually develop the trait, then you could pass on a trait without showing it -- even if the trait is "dominant"!
    • Expressivity  is the degree of the trait.  For example a genetic defect causing mental retardation (such as Fragile X) can result in individuals with a very wide range of intellect; and you cannot predict the degree of expression.

    Top