Assumptions of Mendelian Inheritance

• Constant environment (temperature, nutrition, sunlight etc.)
• Traits only influenced by known gene loci
• Genes assort independently -- zero "linkage"

Know these terms:

• Gene Locus
• Gene Product
• Allele
• Dominant and Recessive alleles; Null alleles
• Trait
• Genotype
• Phenotype
• Hybrid: Monohybrid; Dihybrid -- Dihybrid Cross -- Dihybrid Cross (local copy)
• Self cross
• Test cross or Back cross (when are these the same -- and when not?)
• Probability rules

An allele is a particular version of a given DNA sequence.  "Allele" is a relative term, implying more than one possible version or copy, like different editions of a book.  Like editions of a book, all existing alleles result from a process of change, either gradual or drastic change.

Examples:

Allele 1
        ATCGTTAGATTACAGATTTACCGA
        TAGCAATCTAATGTCTAAATCCGT

Allele 2
        ATCGTTAGATTCCAGATTTACCGA
        TAGCAATCTAAGGTCTAAATCCGT

Allele 3
        ATCGTTAGTGTAATGATTTACCGA
        TAGCAATCACATTACTAAATCCGT

Allele 4
        ATCGTTAG-GATTTACCGA
        TAGCAATC-CTAAATCCGT

Notice that there can be more than two possible alleles for a given gene locus (but only two at a time, in a given diploid individual.)
Multiple alleles can mean  many different possible combinations for individuals.  An example of multiple alleles is human blood type -- A or B alleles encode a blood serum protein, whereas the O allele makes no protein ( a null allele.)  Gene loci which confer traits of tissue type may have 20 or more different alleles.

Natural and "artificial" alleles

• Natural alleles result from evolution, the process of natural selection.
• Artificial alleles can be created by molecular genetics.
• Both natural and artificial alleles can be used by the scientist for breeding purposes.

For a Kenyon student's report on an inherited disease in her family, see Tuberous Sclerosis Complex.

Problem:

Fruit fly eyes have two pigments, brown and scarlet.  Normal flies make
both pigments, but a strain with defective gene B has brown eyes, and a
strain with defective gene S has scarlet eyes.
In the wild type, WHICH GENE (B or S) makes which pigment (brown or scarlet)?Solution

In practice, the most common "new" alleles (arising out of mutation) are often named for a phenotype resulting from the absence of their gene product.  Thus the allele for a gene producing scarlet pigment is named "brown" for the brown eye in the absence of scarlet pigment.

Consider albinism, or loss of pigmentation, a very common phenotype observed in many species of animals and plants.  Alleles can confer loss of pigmentation in two different ways:
 

• Recessive albinism.  The allele encodes an enzyme which converts pigment precursors into dark pigment; or a protein required for pigment deposition.  (Humans; mice; penguins.)
• Dominant color suppression.  The allele encodes a regulatory protein which represses synthesis or deposition of pigment.  (Horse; foxglove)

The reason Mendelian inheritance can be seen to "work" is that in many cases we can hold all the above factors constant, for a given genotype (genes affecting a trait) and a given phenotype (appearance of trait).

• Codominance or incomplete dominance.  Codominant alleles each contribute to the phenotype; for example A and B blood type alleles together produce AB blood type.   Incomplete dominance means that the hybrid produces a lesser degree of the dominant phenotype than the purebreeding dominant.
• Lethality.  If an allele (either dominant or recessive) results in death before birth, a class of progeny will be absent from the offspring.  What ratios will result?

Pleiotropy. One allele (or pair of recessive alleles) at one gene locus can result in many diverse effects throughout the body.

• Allele insertion.  Inject or transfect DNA into a fertilized egg.  The DNA sequence gets taken up somewhere in the genome, but not at the same position as any homologous gene.  The position on the gene map is unpredictable (but fixed once the allele is inserted.)

• Allele replacement.  A DNA sequence containing a linked selective marker (such as drug resistance) is put into embryonic stem cell culture (ES cells).  The ES cells are put into a blastula, which develops into a chimeric offspring; eventually a pure-breeding line is bred.  In this case, the new allele recombines homologously and replaces an allele at a standard map position.

Sickle Cell Anemia.

 Pászty et al, Science 1997 October 31; 278: 876-878.

Sickle-cell disease is caused by a single base pair defect in human beta-globin.

• Double-recessive genotype--red blood cells sickel under stress.
• Single-recessive heterozygote--cells sickle only when attacked by malaria parasites.  Prevents malaria.

For the model strain to exhibit sickle-cell pathology, the native mouse genes--all at separate loci--must be defective (null alleles.)  We have a transgenic mouse strain, containing human Hb-alpha, Hb-beta-sickle on a transgene,Tg(Hu), inserted somewhere in the mouse genome (not at the mouse globin genes.)  But the mouse still has its own genes producingalpha  and beta globin.

To construct this strain, the transgenic strain was intercrossed with a mouse strain heterozygous for null alleles for  alpha and beta globin.

 Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb
 --------     ----------------------       ----------------------
 Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb

                            X

    --         Mouse-alpha-Hb     Mouse-beta-Hb
 --------     --------------------       --------------------
    --            ----                            ----
 

How many generations would you need to cross?
What proportion of mice would show the desired phenotype of blood with entirely human globins?
 

 Tg(Hu)               ----                         ----
 ------------     ------------------     -------------------
 Tg(Hu)            ----                         ----

What would the researchers have to do to create a similar model with exclusively normal human blood?  Why would this be important in order to use the model?  (For further interest, read Ryan et al, 1997.)