1. (4 pts) Here is a coding strand of RNA:

AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA

(A) Translate this strand to form a peptide, using the signals needed by a ribosome.   

(B) Mutate the strand so as to generate a nonsense mutation.  Show the new strand sequence, and the mutant peptide. 

(C) Mutate the strand to generate a frameshift.  Show the new strand sequence, and the mutant peptide.   

2.  (4 pts) Look up the OMIM description of amyotrophic lateral sclerosis (ALS). Based on the detailed description of the disease and its variations:

• Why do different families show different versions of the disease?
• Why do you think only 10% of cases are familial (inherited within families) whereas 90% of cases found in our population result from sporadic mutation events?
• In cases of familial ALS, which kind of alleles (DNA structure) tend to show dominant inheritance?  Which kind of alleles tend to show incomplete penetrance or late onset?  Why do you think this is so?

3.  (2 pts) Your father has been diagnosed with familial ALS at age forty. 
Do you choose to get tested for the disease? 
Explain your decision.  No one answer is "right;" what counts is the thoughtfulness of your reasoning. 

4. (Bonus question, optional, 1 pt) The OMIM site for ALS describes a transgenic mouse model for the purpose of testing therapies for this disease. Explain what you think about generating and maintaining an ALS mouse line. No one answer is "right."