Biomorph
Challenge #5 |
DNA BLAST
Facts about Genomes. See 20 Facts about the Human Genome
Useful Sites
|
|
1. The Biomorphs reveal: "You'll be surprised to learn who we really are. 3 million base pairs of ours differ 100% from yours, though we have as much DNA as you do." What do you say? 2. You are a doctor treating a patient whose leg is eaten away by an infection like "flesh-eating disease." From the infecting bacteria, you obtain the following DNA sequence: CTGCTTCTATAGTTTTTATTTCATCAATATTTATAGGTGGTTTTTCAGTATTGTATTCAAACTTT-TTAGATAAATCACTT
Use the appropriate program (from list above) to determine (A) what kind of bacteria probably has this gene; (B) what kind of protein it encodes. (C) Print out the Genbank record of information about the gene.
3. Paste the DNA gene sequence into Webcutter. Generate a restriction enzyme map showing all the enzyme cut sites in the sequence.
4. How can you use PCR to make many copies of the DNA? Write a pair of two 20-base primer sequences that could be used to amplify (make copies of) the complete gene encoding streptolysin. Remember that the above sequence shows only one strand of the gene; there is always a second complementary strand present.
5. To make an antidote to the protein (encoded by the above sequence), how could you clone an E. coli strain that would express the protein? What additional kind of DNA would have to be used, and how? What kinds of enzymes would be needed?
6. Why is it easier to clone an E. coli strain than to clone a dinosaur? (Explain several reasons).
7. Science fiction: We cannot do this now, but suppose in the future you find a gene that makes an antidote protein to fight the bacteria. You propose to insert this gene into a human genome in order to make someone resistant to the bacteria. In order to insert the resistance gene into human DNA, you need to cut human DNA with a restriction enzyme. For a restriction enzyme of sequence CAATTG, about how many cut sites would you expect in the entire genome? (Note: Use your calculator for a simple calculation; no database needed.)
8. What might The President's Council on Bioethics have to say about the experiment in problem 7? Why might they be concerned about this experiment? |