Biomorph 5 Scores and Key
|
1. The Biomorphs reveal: "You'll be surprised to learn who we really are. 3 million base pairs of ours differ 100% from yours, though we have as much DNA as you do." What do you say? The human genome has 3 billion base pairs. 3 million of these differ from the Biomorph DNA. The "divergent" DNA is only 0.1% of the total. Yet the range of diversity among humans is as much as 0.2%. Thus, Biomorphs appear to be humans; perhaps something like a human "ethnic group." The Biomorphs represent all the humans out there who are trying to trick you with math. Every time you read a newspaper or hear a campaign commercial, you are hearing statements comparable to the Biomorph claims throughout this course. Use what you've learned to defeat the Biomorphs. 2. You are a doctor treating a patient whose leg is eaten away by an infection like "flesh-eating disease." From the infecting bacteria, you obtain the following DNA sequence: CTGCTTCTATAGTTTTTATTTCATCAATATTTATAGGTGGTTTTTCAGTATTGTATTCAAACTTT-TTAGATAAATCACTT
Use the appropriate program (from list above) to determine (A) what kind of bacteria probably has this gene; (B) what kind of protein it encodes. (C) Print out the Genbank record of information about the gene.
(A) The bacteria whose sequences match closest are strains of Staphylococcus aureus, a species that lives on human skin. Some strains cause toxic shock syndrome and "flesh-eating" disease.
(B) The protein sequence is toxin protein "toxin-1". However, other protein sequences mentioned in the genome records were accepted for credit, if you made clear where they came from.
3. Paste the DNA gene sequence into Webcutter. Generate a restriction enzyme map showing all the enzyme cut sites in the sequence.
SfcI
SspI
(The format here is not quite correct, but you get the idea. Most people got this--if you didn't, see me.)
4. How can you use PCR to make many copies of the DNA? Write a pair of two 20-base primer sequences that could be used to amplify (make copies of) the complete gene encoding streptolysin. Remember that the above sequence shows only one strand of the gene; there is always a second complementary strand present.
PCR (polymerase chain reaction) is a way to make many copies of a DNA sequence in a test tube, if you know a short bit of each end of the sequence to be copied. The test tube needs to include: A template DNA to be copied; forward and reverse primers; a polymerase enzyme; and nucleotides to use to build the DNA. Cycles of heating and cooling alternately "melt" the double-stranded DNA into single strands, then cause primers to base-pair and allow the polymerase enzyme to extend complementary DNA strands.
The sequence is always shown with a 5' end at left. DNA must be synthesized from the 5' end toward the 3' end. Its complementary strand (not shown) is pointing 3' to 5'.
Left-end primer: CTGCTTCTATAGTTTTTATT Right-end primer (complementary to the right end, and turned around): AAGTGATTTATCTAAAAAGT
5. To make an antidote to the protein (encoded by the above sequence), how could you clone an E. coli strain that would express the protein? What additional kind of DNA would have to be used, and how? What kinds of enzymes would be needed?
A vector DNA would be needed to clone the gene encoding an antidote protein (a protein that prevents the activity of the toxin protein). The vector would be cut with the same restriction enzyme as the ends of the DNA containing the gene for the antidote. The antidote gene would then be spliced into the vector, and the backbone ends sealed with ligase enzyme. The clonge gene in the vector is put back into an E. coli cell. The E. coli bacteria will then grow exponentially, making many copies of the cloned DNA, and expressing the protein from the clone.
6. Why is it easier to clone an E. coli strain than to clone a dinosaur? (Explain several reasons).
For many reasons, an E. coli strain is easier to clone than a dinosaur. First, we have intact DNA from E. coli, a bacterium that grows and exists today. The dinosaurs went extinct millions of years ago, and their DNA has decayed due to hydrolysis, oxidation, and UV damage. We have not yet been able to recover intact DNA from fossils that old. Even if we had DNA available, it would be in tiny pieces. Fitting all the pieces together would be a challenge; how would we be sure of the correct chromosome structure?
Even if we had intact DNA, E. coli is just a single-celled organism. Dinosaurs are multicellular and require complex patterns of development. What kind of egg would we use to get the DNA started in its developmental program--this is unclear.
7. Science fiction: We cannot do this now, but suppose in the future you find a gene that makes an antidote protein to fight the bacteria. You propose to insert this gene into a human genome in order to make someone resistant to the bacteria. In order to insert the resistance gene into human DNA, you need to cut human DNA with a restriction enzyme. For a restriction enzyme of sequence CAATTG, about how many cut sites would you expect in the entire genome? (Note: Use your calculator for a simple calculation; no database needed.)
(There are ways to select a single restriction site out of many, to insert a gene. This is an advanced topic not covered here.)
The human genome has 3 billion base pairs. The restriction site shown has 6 base pairs. Assuming an equal amount of A, T, C, and G in the genome, the chance of having a particular base at any given point is 1 out of 4. The expected number of cut sites would be:
3
x 109 base pairs / (4)6 base pairs per cut site
8. What might The President's Council on Bioethics have to say about the experiment in problem 7? Why might they be concerned about this experiment?
The President's Council would NOT be concerned with the type of technology per se, that it makes "recombinant DNA" and so forth. They WOULD be concerned with the power of the technology to alter human nature, and to have unexpected effects on society. Making people resistant to a disease is a good thing. But the way this is done--by directly changing a person's DNA--means directly altering the most fundamental aspect of a human being. The antidote protein could have unexpected side effects on the function of the other 30,000 genes in the human genome--a quarter of which are involved in brain function.
Only certain people will have access to this expensive and experimental treatment. We will create a society where certain people resist a disease while others are susceptible. If the cloning is in the "germ line," the trait is inherited by the offspring. Finally, the ability to engineer people with this particular gene might be acceptible, but the technology will be used to engineer people with other genes to make them stronger, better looking, or happier. The President's Council asks whether these uses "beyond therapy" could ultimately mechanize us, diminishing our nature as human beings. |