Human GATA-3

Melissa Skaluba '21 and Lawrence Courtney '21

Contents:

I. Introduction

GATA-3 is a human DNA binding protein that belongs to a family of proteins that all bind to DNA at two conserved regions. One of the unique properties of this family of proteins is the long linker between the two sections of the protein. This allows for very complex and versatile DNA binding patterns between the different proteins.

GATA-3 is an important regulator of T-cell development in humans. It is a transcriptional activator that plays a major role in the expression of T-cell receptors (TCR). Studies have shown that GATA-3 binds to the T-alpha-3 promoter, which contains the conserved GATA sequence. 

GATA-3 also plays a major role in endothelial cell biology. More specifically, GATA-3 binds to the regulatory regions within the 5'-untranslated region of the Tie2 gene and is the main factor in mediating Tie2 expression in human endothelial cells.

II. General Structure

is 155 amino acid residues in length and has two distinct subunits (known as fingers); a C-finger, and an N-finger. These are both characterised by a single alpha-helix and beta-sheet. In additon, the C-finger subunit has an extra helix. This leads to more specific binding. The N-finger and the C-finger are connected via a 30 amino acid residue linker. As mentioned above, the length of this allows for a variety of different interactions between the DNA and the two fingers. After the c-finger, there is a short C-tail that can also interact with the DNA.

III. DNA Binding

GATA-3 can bind to the DNA in two different ways!

In the first of these, the two fingers bind to the same double stranded DNA molecule. It does this by binding to a 20 base pair palindromic sequence, 5� - AATGTCCATCTGATAAGACG - 3�, where the two highlighted sequences are the conserved 4 base pair sequence that GATA-3 recognises.The C-finger will bind to the GATA sequence, and then the linker will interact with one of the adjacent minor grooves. This allows the N-finger to have wrapped around the other side of the DNA molecule and interact with 5� - GATG - 3� sequence (CATC in complementary strand). The C-tail will interact with the remaining unoccupied adjacent minor groove. This leads to the protein forming a parallelogram type structure when full bound to the DNA in this wrapping conformation.

The other way that GATA-3 can interact with DNA is by forming a bridge between two different double stranded molecules. In this type of interaction, the two protein binding sites are separated by 3 base pairs, with a sequence of 5� - TTCCTAAATCAGAGATAACC - 3�. As before, the C-finger binds to the GATA site, with the N-finger binding to the slightly altered GATT site on the complementary strand. In the bridged structure, the main interactions in the sequence specific are the H bonds between the G'13 and the Arg276 and Asn286 residues. There are also H bonds that form between the A and the T in the complementary strand. These interations are stabilised by H bonds that form between Arg276 and Asn286. In this instance, the linker now acts as a bridge, connecting the two DNA molecules together.

All of the interactions with the C-finger and the N-finger happen in the major groove for both the bridging and wrapping DNA binding arrangements.

The major difference in the way these two conformations bind to DNA is Arg367. In the wrapping complex, Arg367 hydrogen bonds to thy10 and thy14, whereas there are very weak interactions between these same molecules in the bridging complex. It has been hypothesised that this is due to the C-tail being able to stabilise the interactions in the wrapping complex.

IV. Application

Why do we care?

Most of the research being done on GATA-3 presently is looking at the effect it has in the development of breast cancer. GATA-3 is known to take part in the cooperative binding of oestrogen receptor (ER), which acts as a transcription factor to induce cell cycle progression. A mutation to the DNA binding domain has been shown to not only directly inhibit some of the binding events of ER to DNA, but also reprogram some of the binding events, making ER bind at a different location on the DNA. It is relatively unknown how GATA-3 interacts with ER. One thought is that these different binding events could be the cause of various types of tumour.

V. References

Carrol, J. (n.d.). Carroll Group: Nuclear Receptor Transcription. Retrieved from https://www.cruk.cam.ac.uk/research-groups/carroll-group

Ho IC, Vorhees P, Marin N, Oakley BK, Tsai SF, Orkin SH, Leiden JM. Human GATA-3: a lineage-restricted transcription factor that regulates the expression of the T cell receptor alpha gene. The EMBO journal. 1991;10:1187�1192.

J Chou, S Provot, Z Werb.  GATA3 in Development and Cancer Differentiation: Cells GATA Have It! J Cell Physiol. 2010 Jan; 222(1): 42�49.

Song H, Suehiro J-i, Kanki Y, Kawai Y, Inoue K, Daida H, Yano K, Ohhashi T, Oettgen P, Aird WC, et al. Critical Role for GATA3 in Mediating Tie2 Expression and Function in Large Vessel Endothelial Cells. Journal of Biological Chemistry. 2009;284:29109�29124.

Y. Chen, D. L. Bates, R. Dey, P. Chen, A. C. D. Machado,I. A. Laird-Offringa, R. Rohs, and L. Chen. 2012. Cell Reports. �DNA Binding by GATA Transcription Factor Suggests Mechanisms of DNA Looping and Long-Range Gene Regulation.� Volume 2: 1197-1206

Back to Top