DNA Structure

Helical forms of DNA

DNA Replication

Mendelian inheritance

Alleles: What are they?

Deoxyribonucleic acid (DNA) was first identified in 1868 by Friedrich Miescher, a Swiss biologist, in the nuclei of pus cells obtained from discarded surgical bandages.  The substance he found contained an acidic part,  nucleic acid, and a basic (alkaline) part, which we now know to be histone proteins, which bind to the nucleic acid.

Which component was  the genetic material?   Many scientists were sure that it was protein.   After all, protein had so many subunits (20 amino acids) that it seemed obvious that there existed within protein the possibility for much more diversity in expressing the genetic code than in DNA, which only has 4 subunits.  Each subunit is identical except for the base:

In 1943, Oswald Avery, Colin Macleod, and Maclyn McCarty, at the Rockefeller Institute, discovered that different strains of the bacterium Strepotococcus pneumonae could have different  effects on a mouse. One virulent strain could kill an injected mouse, and another avirulent strain had no effect. When the virulent strain was heat-killed and injected into mice, there was no effect.  But when a heat-killed virulent strain was coinjected with the avirulent strain, the mice died. What transforming principle was the dead virulent strain giving to the avirulent strain to make it lethal?

This phenomenon of transformation, the uptake of DNA and incorporation into a genome, is now commonly performed in biotechnology..

In 1950, Erwin Chargaff at Columbia University discovered that no matter what tissue from an animal he looked at, the percentage content of each of the four nucleotides was the same, though the percentages could vary from species to species.   In all animals:

                                  %G = %C
                                  %A = %T

The significance of these results was overlooked for three years, but they were crucial to elucidating the structure of DNA.

In late 1953, James Watson and Francis Crick presented a model of the structure of DNA (see their paper in Nature.) It was already known from chemical studies that DNA was a polymer of nucleotide (sugar, base and phosphate) units. X-ray crytallographic data obtained by Rosalind Franklin, combined with the previous results from Chargaff and the chemists, were fitted together by Watson and Crick, who "borrowed" the data from Franklin's grant proposal. After several false starts, including the wrong tautomeric forms of the bases, they devised this model:

Under most cellular conditions, this double-stranded DNA molecule will coil naturally into a B-form helix, with one turn per 10.4 base pairs.  However other structures are possible (see below).

Each strand of the DNA is composed of  nucleotides:

The nucleotides form base pairs:

MIT Hypertextbook.

Adenine pairs with Thymine because they make two hydrogen bonds.
Guanine pairs with Cytosine because they make three hydrogen bonds.

The stacked base pairs form a major groove and a minor groove.  Different regulatory proteins will bind to the major or minor groove.  See Space-filling Model.

Each base attaches to a phosphate at its 3' OH, and its 5'OH.   The 2' carbon position has no OH; hence the "deoxy" part of DNA.  The lack of  2' OH greatly stabilizes DNA, compared to RNA, because it prevents the intramolecular hydrolysis of phosphate linkages.

The base pairs "stack" together like rungs on a ladder, because of favorable interactions between the pi orbitals extending out of the heteroaromatic ring structure of each base.
 

The structure of B-form DNA helix was first determined by X-ray analysis of crystalized molecules.
However, other forms of helix can be stable under certain conditions of salt, pH, and temperature.  In fact, triple-helical forms (triplex DNA, H form) have been found.

Certain regulatory sites within cells appear to have DNA sequence that takes a non-standard form, sometimes assisted by a protein.

Moreover, DNA technologists are making use of unusual DNA properties to construct genetic medicines.  Genetic medicines are pieces of artificial DNA that can hybridize to a region of the genome and turn off transcription of genes, such as a cancer gene.

Stability of DNA
DNA is a stable molecule; short pieces of DNA can remain intact in fossils and mummies for thousands of years.

However, in water solution certain chemical conditions can destabilize DNA.
For example:
   Acid (low pH) causes detachment of purines from the backbone.
  Alkali (high pH) prevents hydrogen bonding, so the two strands come apart.
This is one reason that all living things have to regulate their own pH, as studied by Kenyon students in the NSF-funded Bacterial pH Research Lab.

Supercoiling

In nearly all living cells, DNA contains negative superturns.  This means it is "underwound," like a piece of yarn that has been twisted in the opposite direction that the multiple strands are wound.  This is called negative supercoiling.  Negative supercoiling may assist replication and transcription of DNA by lowering the energy needed to melt the helix.   See the molecule Topoisomerase.

In bacteria, negative superturns are maintained by the closed circular structure of the chromosome: It is impossible to unwind the superturns.

In eukaryotes, negative superturns are maintained by the winding of the DNA helix around histone proteins.

1.  Early life simulation experiments show that the base adenine would have formed spontaneously out of hydrogen cyanide, on the anaerobic early Earth.  Show how five molecules of HCN can fit together to form exactly one molecule of adenine.

2.  What kind of charge is on most of the proteins that take up 60% of the chromosome?  Why?

3.  If chemical analysis of a genome reveals 23% guanine, what are the percentages of the other three bases-- A, T, and C?

4.  If a certain DNA site needs to come apart easily, for regulatory functions, what kind of base pairs are likely to be favored at that site?

5.  Suppose an aromatic molecule with lots of pi orbitals could insert between two base pairs like a sandwich.  What would happen as enzymes "read" the DNA information?

6.  Some Archaea (microbes of the third Kingdom of organisms) living at extremely high temperature and pressure have positively supercoiled DNA.  Why?

Solutions

DNA replicates semiconservatively.  Replication starts by opening of the DNA helix at a particular sequence called an origin of replication (ori).   Bacteria, even during logarithmic growth, have ONE map position where DNA can originate replication.    Eukaryotes have MANY origins of replication, all of which run concurrently.  In either case, each origin of replication runs bidirectionally, with TWO replicating forks.

Bidirectional semiconservative replication can be demonstrated by observing DNA from cells replicating in the presence of radiolabeled nucleotides.  Both sides of the dividing DNA will be labeled.  What would the above diagrams look like, if the replicating DNA were radiolabeled?

Molecular Steps of DNA Replication

Replication of DNA is mediated by enzymes and binding proteins.   One crucial function is to unwind the helix, enabling it to "unzip" exposing bases to pair with the growing strand.  How can the helix be unwound without falling apart?  To see an example, view topoisomerase I.

 DNA replication must be fast and accurate.  To follow the step by step process, click the image:

• Constant environment (temperature, nutrition, sunlight etc.)
• Traits only influenced by known gene loci
• Genes assort independently -- zero "linkage"

Know these terms:

• Gene Locus
• Gene Product
• Allele
• Dominant and Recessive alleles; Null alleles
• Trait
• Genotype
• Phenotype
• Hybrid: Monohybrid; Dihybrid -- Dihybrid Cross -- Dihybrid Cross (local copy)
• Self cross
• Test cross or Back cross (when are these the same -- and when not?)
• Probability rules

An allele is a particular version of a given DNA sequence.  "Allele" is a relative term, implying more than one possible version or copy, like different editions of a book.  Like editions of a book, all existing alleles result from a process of change, either gradual or drastic change.

Examples:

Allele 1
        ATCGTTAGATTACAGATTTACCGA
        TAGCAATCTAATGTCTAAATCCGT

Allele 2
        ATCGTTAGATTCCAGATTTACCGA
        TAGCAATCTAAGGTCTAAATCCGT

Allele 3
        ATCGTTAGTGTAATGATTTACCGA
        TAGCAATCACATTACTAAATCCGT

Allele 4
        ATCGTTAG-GATTTACCGA
        TAGCAATC-CTAAATCCGT

Notice that there can be more than two possible alleles for a given gene locus (but only two at a time, in a given diploid individual.)
Multiple alleles can mean  many different possible combinations for individuals.  An example of multiple alleles is human blood type -- A or B alleles encode a blood serum protein, whereas the O allele makes no protein ( a null allele.)  Gene loci which confer traits of tissue type may have 20 or more different alleles.

Natural and "artificial" alleles

• Natural alleles result from evolution, the process of natural selection.
• Artificial alleles can be created by molecular genetics.
• Both natural and artificial alleles can be used by the scientist for breeding purposes.

For a Kenyon student's report on an inherited disease in her family, see Tuberous Sclerosis Complex.

Problem:

Fruit fly eyes have two pigments, brown and scarlet.  Normal flies make
both pigments, but a strain with defective gene B has brown eyes, and a
strain with defective gene S has scarlet eyes.
In the wild type, WHICH GENE (B or S) makes which pigment (brown or scarlet)?Solution

In practice, the most common "new" alleles (arising out of mutation) are often named for a phenotype resulting from the absence of their gene product.  Thus the allele for a gene producing scarlet pigment is named "brown" for the brown eye in the absence of scarlet pigment.

Consider albinism, or loss of pigmentation, a very common phenotype observed in many species of animals and plants.  Alleles can confer loss of pigmentation in two different ways:
 

• Recessive albinism.  The allele encodes an enzyme which converts pigment precursors into dark pigment; or a protein required for pigment deposition.  (Humans; mice; penguins.)
• Dominant color suppression.  The allele encodes a regulatory protein which represses synthesis or deposition of pigment.  (Horse; foxglove)

The reason Mendelian inheritance can be seen to "work" is that in many cases we can hold all the above factors constant, for a given genotype (genes affecting a trait) and a given phenotype (appearance of trait).

• Codominance or incomplete dominance.  Codominant alleles each contribute to the phenotype; for example A and B blood type alleles together produce AB blood type.   Incomplete dominance means that the hybrid produces a lesser degree of the dominant phenotype than the purebreeding dominant.
• Lethality.  If an allele (either dominant or recessive) results in death before birth, a class of progeny will be absent from the offspring.  What ratios will result?

Pleiotropy. One allele (or pair of recessive alleles) at one gene locus can result in many diverse effects throughout the body.

• Allele insertion.  Inject or transfect DNA into a fertilized egg.  The DNA sequence gets taken up somewhere in the genome, but not at the same position as any homologous gene.  The position on the gene map is unpredictable (but fixed once the allele is inserted.)

• Allele replacement.  A DNA sequence containing a linked selective marker (such as drug resistance) is put into embryonic stem cell culture (ES cells).  The ES cells are put into a blastula, which develops into a chimeric offspring; eventually a pure-breeding line is bred.  In this case, the new allele recombines homologously and replaces an allele at a standard map position.

Sickle Cell Anemia.

 Pászty et al, Science 1997 October 31; 278: 876-878.

Sickle-cell disease is caused by a single base pair defect in human beta-globin.

• Double-recessive genotype--red blood cells sickel under stress.
• Single-recessive heterozygote--cells sickle only when attacked by malaria parasites.  Prevents malaria.

For the model strain to exhibit sickle-cell pathology, the native mouse genes--all at separate loci--must be defective (null alleles.)  We have a transgenic mouse strain, containing human Hb-alpha, Hb-beta-sickle on a transgene,Tg(Hu), inserted somewhere in the mouse genome (not at the mouse globin genes.)  But the mouse still has its own genes producingalpha  and beta globin.

To construct this strain, the transgenic strain was intercrossed with a mouse strain heterozygous for null alleles for  alpha and beta globin.

 Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb
 --------     ----------------------       ----------------------
 Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb

                            X

    --         Mouse-alpha-Hb     Mouse-beta-Hb
 --------     --------------------       --------------------
    --            ----                            ----
 

How many generations would you need to cross?
What proportion of mice would show the desired phenotype of blood with entirely human globins?
 

 Tg(Hu)               ----                         ----
 ------------     ------------------     -------------------
 Tg(Hu)          ----                         ----

What would the researchers have to do to create a similar model with exclusively normal human blood?  Why would this be important in order to use the model?  (For further interest, read Ryan et al, 1997.)