How are Genes Expressed?

BIOL 114
Biology Dept
Kenyon College

How are genes expressed?


1	Where does the RNA polymerase initiate transcription of the message?
		The origin site on DNA is where transcription starts.
		The centromere of a chromosome contains central genes.
		The promoter region upstream of a gene.
		The exon, where the sequence encodes protein.


2	Which sequences below (there are two of them) might each include a promoter?
		TCAGAGTAGTCATTATAATAGGCCTTGC
		TCCGATAGCAGCGCTGCGCCATAGAC
		TGCGCAATCGCATTAGCGCGGCCATAG
		TAGTACGAATATAATCTACAACTAGCTCATG


3	Which of these regulatory events is needed to transcribe the lac operon?
		The allolactose inducer binds to the lac repressor.
		The catabolite activator protein (CAP) binds to cAMP.
		Both inducer binds to lac repressor and cAMP binds to CAP.
		Neither event is needed.


4	Which of these subunits of bacterial RNA polymerase fall off before transcription continues beyond the promoter?
		The sigma subunit falls off, leaving a core polymerase which binds less tightly to DNA.
		The alpha subunit falls off.
		The beta subunit falls off.
		The alpha and beta subunits fall off, leaving only sigma to continue transcription.


5	In this diagram of the eukaryotic promoter, what molecule binds to the TATA box, and why? .
		^{The RNA polymerase II binds to TATA and initiates transcription.}
		The TATA binding protein binds to TATA and to RNA Pol II to initiate transcription.
		^{The lac repressor binds to TATA, to make sure that the eukaryotic gene stays turned off.}
		A transcription factor binds to activate transcription.


6	Here is another view of eukaryotic transcription. What is the role of the enhancer sequence? .
		The enhancer binds to the promoter to activate transcription.
		The enhancer binds to the coding region.
		The enhancer sequence binds to TATA binding protein and RNA pol II.
		The enhancer sequence binds to a transcription factor, which binds TATA binding protein, activating transcription.