1.  Explain how RNA gets transcribed from DNA.  Explain the mechanisms of initiation and elongation.  How does RNA polymerase know where to start?  How does it get past the initiation site?  What different kinds of RNA are made, and for what purpose?  Which kinds do NOT get translated to protein? 

2.  Here is a piece of mRNA sequence:

UGGCGCACCGAAUGGUUAUAAGCCGCCCCUAGUUUCCGCAAUUAGGG

Translate it to a peptide.  Generate mutations: missense, nonsense, frameshift.  Translate the new peptide, if any.

3.  Show the steps of the splicing reaction that splices out the intron between two exons of mRNA.  Include the role of the spliceosome.  In what kind of organism does this happen?  Where in the cell?

4.  Show the steps of translation of an mRNA to make a protein.  Explain the parts of the ribosome and how everything fits together.

5.  How do some proteins get into the membrane, or get across the membrane to be secreted?  Why do these proteins need special helper complexes?

6.  Explain the differences between: dominant gain-of-function allele; dominant loss-of-function (haploinsufficiency); recessive gain-of-function (haploinsufficiency); recessive loss-of-function.

7.  Explain the different roles and effects of mutation in : carcinogenesis (appearance of cancer); immune system development; and molecular evolution. 

8. Where is mutation "programmed" by the organism, and how?  Explain for humans and for pathogens.

9.  Recognize the molecular structure of a tRNA; a mismatched DNA duplex; a ribosome.

10.  Understand chromosomal mutations: deletions, inversions, aneuploidy (loss of a chromosome), triploidy (extra chromosome).  Be able to read and figure out a paragraph from OMIM.

11.  Explain how bacteria acquire DNA by transformation.  What makes the DNA uptake possible?  Why has this capability evolved?

12.  Explain two DIFFERENT ways that bacteriophages can transfer host genomic DNA from one bacterial cell to the next one infected.  Explain how two different phage life cycles make this possible.  In which case does the phage add a piece of extra DNA to the host genome; and in which case does the transferred piece of DNA replace a host allele?

13.  Explain how plasmids can transfer genes between cells through conjugation.   Why do bacteria keep plasmids they acquire?  How does natural selection maintain the plasmid?

14.  What is a transposon?  What parts does it need to function?  How do transposons relate to drug-resistance plasmids?

15.  Explain the difference between vertical gene transfer and horizontal or lateral gene transfer.  Does lateral gene transfer occur in humans?  Explain.

16. Read these two pages from OMIM and understand the genetic issues: Duchenne muscular dystrophy, and myasthenic syndrome.