![]() Biology Dept Kenyon College |
1. (4 pts) Here is a coding strand of RNA: AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA (A) Translate this strand to form a peptide, using the signals needed by a ribosome. (B) Mutate the strand so as to generate a nonsense mutation. Show the new strand sequence, and the mutant peptide. (C) Mutate the strand to generate a frameshift. Show the new strand sequence, and the mutant peptide. 2. (4 pts) Look up the OMIM description of amyotrophic lateral sclerosis (ALS). Based on the detailed description of the disease and its variations:
3. (2 pts) Your father has been diagnosed with
familial ALS at age forty. 4. (Bonus question, optional, 1 pt) The OMIM site for ALS describes a transgenic mouse model for the purpose of testing therapies for this disease. Explain what you think about generating and maintaining an ALS mouse line. No one answer is "right." |