1.  (4 pts) Here is a coding strand of RNA:

AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA

Translate this strand to form a peptide, using the signals needed by a ribosome.

AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA
        MetTrpThrCysLeuAsnAlaValPro(Stop)

Mutate the strand so as to generate a nonsense mutation.  Show the new strand sequence, and the mutant peptide.  More than one answer is possible.

AUUGCGAAAUGUGGACGUGACUCAAUGCAGUGCCUUGAUCUAAAGA
        MetTrpThr(Stop)

Mutate the strand to generate a frameshift.  Show the new strand sequence, and the mutant peptide.  More than one answer is possible.

AUUGCGAAAUGUGGACGUGCCUCAAUCGCAGUGCCUUGAUCUAAAGA
        MetTrpThrCysLeuAsnArgSerAlaLeuIle(Stop)

2. (4 pts) Look up the description of amyotrophic lateral sclerosis (ALS). Based on the detailed description of the disease and its variations:

• Why do different families show different versions of the disease?

Different families inherit different alleles of the gene, or defective alleles of different genes.  Defects in several different genes can cause the same disease.
 
• Why do you think only 10% of cases are familial (inherited within families) whereas 90% of cases found in our population result from sporadic mutation events?

In most cases, the mutation event causes such a severe defect that the individual dies well before reproductive age.  Thus, most mutation events result in "sporadic cases."  The allele gets inherited only if it causes a relatively mild defect, such as a missense mutation resulting in a partly functional protein.
 
• In cases of familial ALS, which kind of alleles (DNA structure) tend to show dominant inheritance? 


Deletions, inversions and frameshifts that knock out the gene tend to show dominant inheritance through haploinsufficiency.
Which kind of alleles tend to show incomplete penetrance or late onset? 
Smaller mutations such as missense may show incomplete penetrance or late onset.
 Why do you think this is so?
The partially functional protein is available.  Whether its function is good enough may depend upon other variables in the patient's physiology.

About X-linkage:  Only one family, out of many studied, showed an an X-linked gene causing ALS.  All the others chromosomes are clearly stated to be autosomal (for example chromosome 11 or 21). 

Reasons to get tested:

• There is 50% chance you don't have it, and can live your life not worrying about it.
• If you do have the allele, you can plan ahead to do things you want to do, and keep track of new medical developments for prevention and treatment.
• You can make decisions about having children, and about informing other relatives.

• Once you know you have the disease, it becomes a "preexisting condition" for insurance.  Insurers may refuse to provide coverage.
• Employers and associates may find out; depending on your career and life style, this may or may not be important to you.
• You may prefer living without the knowledge, since the disease is something that cannot be prevented at this time.

4. (Bonus question, optional, 1 pt) The OMIM site for ALS describes a transgenic mouse model for the purpose of testing therapies for this disease. Explain what you think about generating and maintaining an ALS mouse line. No one answer is "right."

Most people accept the fact that our society condones many forms of pain and harm to animals, from slaughter for food to experimental research. At the same time, organizations try to minimize (SPCA) or eliminate harm to animals (PETA). The Federal Animal Welfare Act regulates treatment of animals so as to avoid "unnecessary" suffering. But maintaining a line such as ALS mice requires continual breeding of newly diseased animals, whether or not they are being studied at a given time. The question of breeding animals deliberately to experience genetically determined suffering is a new issue that receives relatively little attention, but will be a growing issue as growing numbers of "defective" organisms are bred.