|
Biology Dept Kenyon College |
|
1. (4 pts) Here is a coding strand of RNA: AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA Translate this strand to form a peptide, using the signals needed by a ribosome. AUUGCGAAAUGUGGACGUGCCUCAAUGCAGUGCCUUGAUCUAAAGA
Mutate the strand so as to generate a nonsense mutation. Show the new strand sequence, and the mutant peptide. More than one answer is possible. AUUGCGAAAUGUGGACGUGACUCAAUGCAGUGCCUUGAUCUAAAGA
Mutate the strand to generate a frameshift. Show the new strand sequence, and the mutant peptide. More than one answer is possible. AUUGCGAAAUGUGGACGUGCCUCAAUCGCAGUGCCUUGAUCUAAAGA
2. (4 pts) Look up the description of amyotrophic lateral sclerosis (ALS). Based on the detailed description of the disease and its variations:
Different families inherit different alleles of the gene, or defective alleles of different genes. Defects in several different genes can cause the same disease. In most cases, the mutation event causes such a severe defect that the individual dies well before reproductive age. Thus, most mutation events result in "sporadic cases." The allele gets inherited only if it causes a relatively mild defect, such as a missense mutation resulting in a partly functional protein.
About X-linkage: Only one family, out of many studied, showed an an X-linked gene causing ALS. All the others chromosomes are clearly stated to be autosomal (for example chromosome 11 or 21). Do you choose to get tested for the disease? Explain your decision. No one answer is "right;" what counts is the thoughtfulness of your reasoning. Reasons to get tested:
4. (Bonus question, optional, 1 pt) The OMIM site for ALS describes a transgenic mouse model for the purpose of testing therapies for this disease. Explain what you think about generating and maintaining an ALS mouse line. No one answer is "right." Most people accept the fact that our society condones many forms of pain and harm to animals, from slaughter for food to experimental research. At the same time, organizations try to minimize (SPCA) or eliminate harm to animals (PETA). The Federal Animal Welfare Act regulates treatment of animals so as to avoid "unnecessary" suffering. But maintaining a line such as ALS mice requires continual breeding of newly diseased animals, whether or not they are being studied at a given time. The question of breeding animals deliberately to experience genetically determined suffering is a new issue that receives relatively little attention, but will be a growing issue as growing numbers of "defective" organisms are bred. |