Generation of Phylogenetic Tree based upon DNA sequence analysis

Generation of Phylogenetic Tree based upon DNA sequence analysis is a lab exercise created by Scott Cooper, Associate Professor of Biology at University of Wisconsin at La Crosse.  Cosmetic alterations only were made by Nigel Goldenfeld and Ray Heithaus

There are two steps to creating a phylogenetic tree:

Using Biology WorkBench to align two or more sequences.

First we will align DNA sequences from the Mitochondrial D-loop from five species (Human, Chimp, Gorilla, Orangutan and Neanderthal).   These sequences can be found at the site Primates .  They have also been pasted below.

Log onto the Biology WorkBench, register (be sure to write down your username and password), then select Session Tools and create a new session named phylo, then select run. 

Select  Nucleic Tools and then scroll down to Add New Sequence.

Create files for each species. Fill in the "name" window, then paste in the mitochondrial D-loop sequence. Edit to make sure there are no spaces inside the sequences. Select run for each species to save the file.

Select the sequences that you wish to align by clicking the box next to each file, and then select CLUSTALW (scroll down the options window if necessary).  

You will now be given some options on parameters you can change in your alignment.  You can just use the default values and select Submit at the bottom of the page.

1) What happens with the alignment?

2) What rules do you think are used to create an alignment?

Select Import Alignment(s).  This will save this alignment in a single file for further analysis.

 

Using Biology WorkBench to create a phylogenetic tree.

Next select Alignment Tools select the aligned sequences by clicking the box next to the file name.

Next click either the button DRAWTREE or DRAWGRAM.

DRAWTREE draws a rooted tree.

DRAWGRAM draws an unrooted tree.

3) What is the difference between a "rooted" and an "unrooted" tree?

You will now be given some options on parameters you can change in your alignment.  You can just use the default values and select Submit at the bottom of the page.

The tree will now appear.

Congratulations you are now an evolutionary biologist.

Analysis of trees

    Examine your tree. 

    4) Which species appear to be the most closely related? 

    5) From your tree, does it appear that Neanderthals were direct ancestors of humans, or did we share a common ancestor that branched off from the other apes?   

    6) Try this analysis with DNA sequences from 4-5 other species of your choosing.

 

Example D-loop hypervariable regions from five primate species.

>gi|2286205|gb|AF011222.1| Homo sapiens neanderthalensis mitochondrial D-loop hypervariable region 1
GTTCTTTCATGGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAGCAACCGCTATGTATCTCGTACATTACTGTTAGTTACCATGAATATTGTACAGTACC ATAATTACTTGACTACCTGCAGTACATAAAAACCTAATCCACATCAAACCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACA ACTCCAAAGACGCCCTTACACCCACTAGGATATCAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACAGTCAAATCCCTT CTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGAT

>neanderthal_2000
CCAAGTATTGACTCACCCATCAACAACCGCCATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACCATAATTACTTGACTACCTGTAATACATAAAAAC CTAATCCACATCAACCCCCCCCCCCCATGCTTACAAGCAAGCACAGCAATCAACCTTCAACTGTCATACATCAACTACAACTCCAAAGACACCCTTACACCCACTAGGATAT CAACAAACCTACCCACCCTTGACAGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTATAGTCAAATCCCTTCTCGCCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGA

>gi|975204|emb|X90314.1|MTHSWGICB H.sapiens mitochondrial DNA for D-loop (isolate WG+ice37+B)
TTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCA TAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAA CTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCT CGTCCCCATGGATGACCCCCCTCA

>gi|3766221|gb|AF089820.1|AF089820 Gorilla gorilla beringei mitochondrial D-loop, partial sequence
TTCTTTCATGGGGAGACGAATTTGGGTGCCACCCAAGTATTAGTTAACCCACCAATAATTGTCATGTATGTCGTGCATTACTGCCAGCCACCATGAATAATGTACAGTACCA CAAACACTCCCCCACCTATAATACATTACCCCCCCTCACCCCCCATTCCCTGCTCACCCCAACGGCATACCAACCAACCTATCCCCTCACAAAAGTACATAATACATAAAAT CATTTACCGTCCATAGTACATTCCAGTTAAACCATCCTCGCCCCCACGGATGCCCCCCTTCAGATAGGGATCCCTTAAACACCATCCTCCGTGAAATCAATATCCCGCACAA GAGTGCTACTCTCCTCGCTCCGGGCCCATAACACCTGG

>gi|6288860|gb|AF176766.1|AF176766 Pan troglodytes troglodytes isolate DODO mitochondrial D-loop, partial sequence
GTACCACCTAAGTATTGGCCTATTCATTACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACAGTACTATAACCACTCAACTACCTATAATACAT TAAGCCCACCCCCACATTACAACCTCCACCCTATGCTTACAAGCACGCACAACAATCAACCCCCAACTGTCACACATAAAATGCAACTCCAAAGACACCCCTCTCCCACCCC GATACCAACAAACCTATGCCCTTTTAACAGTACATAGTACATACAGCCGTACATCGCACATAGCACATTACAGTCAAATCCATCCTTGCCCCCACGGATGCCCCCCCTCAGATAGG

>gi|1743293|emb|X97708.1|MIPACONTR P.abelii (YN91-227) mitochondrial DNA for control region
TTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGGCCTATGTATTTCGTACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAA TCGCTTAACCAACTATAATGCATACAAAACTCCAACCACACTCGACCTCCACACCCCGCTTACAAGCAAGTACCCCCCCATGCCCCCCCACCCAAACACATACACCGATCTC TCCACATAACCCCTCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTACATAGCACATACTATCCTAACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCC CCACGGATGCCCCCCCTCAGTTAGTAATCCCTTACTCACCATCCTCCG