Test 3.  Practice Questions

1.  Explain the chemistry of the mutations most likely to increase under the following conditions:  (a) Exposure in a tanning salon; (b) flying planes for a commercial airline; (c) consuming a high-sugar diet, which elevates the rate of respiration.

2.  Explain how mutations are classified based on DNA sequence, and how they are classified based on phenotype.  Explain examples of how DNA sequence changes can lead to: premature termination of a protein; overexpression of a cell cycle regulator; loss of five hundred proteins.  Explain how specific chemical changes can lead to DNA sequence changes such as: a transition mutation; a transversion mutation; a chromosome rearrangement.

3.  Explain the function of these components of the replisome: the core polymerase; the beta clamp; and the clamp loader.  Explain how the molecular form of each component relates to its function.

4.  Explain the structures of the two MutS models (November 7).  Explain why their structures differ, and how they relate to the function of MutS.  Explain what kind of DNA repair is involved, and what are the other components associated with MutS.

5.  Explain how DNA recombination relates to DNA repair.  Explain the difference between homologous and non-homologous recombination; both associated with repair, and associated with non-repair biological processes.

6. Determine the best likely alignment for the following two sequences.

Explain what problems arise for computational alignment of sequences.

ACCGCTCTGGGCAACTACTGACCGAGGTATTCCAT

TCCGCCCTGGACAATCGCTACTGGCCGATATCCCA

7. Explain the basis for annotation of gene sequences to reveal coding genes.  Explain what assumptions are used for bacterial genes, versus the assumptions for animal or plant genes.