Facts about Genomes. See 20 Facts about the Human Genome

There are 100 trillion (10¹²) cells in your body. Each cell contains DNA double helix totalling three billion (3 x 10⁹) base pairs.
If unwound and linked together, the strands of DNA in one cell would stretch almost six feet but would be only 50 trillionths of an inch wide.
It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence, if you read at a rate of 10 bases per second.
If all the DNA in your body was put end to end, it would reach to the sun and back over 600 times (100 trillion times six feet divided by 92 million miles).
Human DNA is 98 percent identical to chimpanzee DNA. Human DNA is 30% identical to E. coli DNA.
The average amount of genetic difference between any two humans is 0.2 %, or one in 500 bases. Chimpanzees differ by 0.8 %.

Useful Sites

NCBI (National Center for Biotechnology Information)
OMIM (Online Mendelian Inheritance in Man)
BLAST DNA-DNA comparison
Webcutter Restriction enzyme mapping
Human Genome
Bacterial Genomes

1. Suppose Bigfoot trackers in Siberia discover a blue-furred monster whose genome is about as large as ours, but differs from ours by 3 million base pairs. Do you think the creature is human? On what basis do you decide?

2. You are a doctor treating a patient whose leg is eaten away by an infection like "flesh-eating disease." From the infecting bacteria, you obtain the following DNA sequence:

CTGCTTCTATAGTTTTTATTTCATCAATATTTATAGGTGGTTTTTCAGTATTGTATTCAAACTTT-TTAGATAAATCACTT

Use the appropriate program (from list above) to determine (A) what kind of bacteria probably has this gene; (B) what kind of protein it encodes. (C) Print out the Genbank record of information about the gene.

3. Paste the DNA gene sequence into Webcutter. Generate a restriction enzyme map showing all the enzyme cut sites in the sequence.

4. How can you use PCR to make many copies of the DNA? Write a pair of two 20-base primer sequences that could be used to amplify (make copies of) the complete gene encoding streptolysin. Remember that the above sequence shows only one strand of the gene; there is always a second complementary strand present.

5. To make an antidote to the protein (encoded by the above sequence), how could you clone an E. coli strain that would express the protein? What additional kind of DNA would have to be used, and how? What kinds of enzymes would be needed?

6. Why is it easier to clone an E. coli strain than to clone a dinosaur? (Explain several reasons).

7. Suppose that a tsunami devastates a coastal city, and afterward a baby gets rescued. We use DNA testing to match the baby to one of three pairs of parents (1, 2, 3). Here are the results of the DNA test:

8. Suppose a population of a DNA-based life form grows according to the following curve.

(A) Sketch the profile of growth rate (rate of change of population size, at a given time) as a function of time.