BIOL 114
Biology Dept
Kenyon College
Chapter 1 (cont.):
DNA Structure and 
Mendelian Inheritance
Fall SectionSpring Section 1Spring Section 2
  • DNA Structure
  • Helical forms of DNA
  • DNA Replication
  • Mendelian inheritance
  • Alleles: What are they?


  • DNA Structure                               Note: Much of this modified from the MIT Hypertextbook.

    Deoxyribonucleic acid (DNA) was first identified in 1868 by Friedrich Miescher, a Swiss biologist, in the nuclei of pus cells obtained from discarded surgical bandages.  The substance he found contained an acidic part,  nucleic acid, and a basic (alkaline) part, which we now know to be histone proteins, which bind to the nucleic acid.

    Which component was  the genetic material?   Many scientists were sure that it was protein.   After all, protein had so many subunits (20 amino acids) that it seemed obvious that there existed within protein the possibility for much more diversity in expressing the genetic code than in DNA, which only has 4 subunits.  Each subunit is identical except for the base:

    MIT Hypertextbook

    Learn these structures. Click here for Quiz!



    The Transforming Principle - DNA Might be the Genetic Material


    MIT Hypertextbook

    In 1943, Oswald Avery, Colin Macleod, and Maclyn McCarty, at the Rockefeller Institute, discovered that different strains of the bacterium Strepotococcus pneumonae could have different  effects on a mouse. One virulent strain could kill an injected mouse, and another avirulent strain had no effect. When the virulent strain was heat-killed and injected into mice, there was no effect.  But when a heat-killed virulent strain was coinjected with the avirulent strain, the mice died. What transforming principle was the dead virulent strain giving to the avirulent strain to make it lethal?

    This phenomenon of transformation, the uptake of DNA and incorporation into a genome, is now commonly performed in biotechnology..


    Chargaff - Nucleotide Content in DNA

    In 1950, Erwin Chargaff at Columbia University discovered that no matter what tissue from an animal he looked at, the percentage content of each of the four nucleotides was the same, though the percentages could vary from species to species.   In all animals:

                                      %G = %C
                                      %A = %T

    The significance of these results was overlooked for three years, but they were crucial to elucidating the structure of DNA.



    Watson and Crick - The Double Helix

    In late 1953, James Watson and Francis Crick presented a model of the structure of DNA (see their paper in Nature.) It was already known from chemical studies that DNA was a polymer of nucleotide (sugar, base and phosphate) units. X-ray crytallographic data obtained by Rosalind Franklin, combined with the previous results from Chargaff and the chemists, were fitted together by Watson and Crick, who "borrowed" the data from Franklin's grant proposal. After several false starts, including the wrong tautomeric forms of the bases, they devised this model:


    Tom Strachan and Andrew P. Read, Human Molecular Genetics, BIOS

    Molecular model here.

    Under most cellular conditions, this double-stranded DNA molecule will coil naturally into a B-form helix, with one turn per 10.4 base pairs.  However other structures are possible (see below).

    Each strand of the DNA is composed of  nucleotides:


    MIT Hypertextbook.

    The nucleotides form base pairs:


    MIT Hypertextbook.

    Adenine pairs with Thymine because they make two hydrogen bonds.
    Guanine pairs with Cytosine because they make three hydrogen bonds.

    The stacked base pairs form a major groove and a minor groove.  Different regulatory proteins will bind to the major or minor groove.  See Space-filling Model.

    Each base attaches to a phosphate at its 3' OH, and its 5'OH.   The 2' carbon position has no OH; hence the "deoxy" part of DNA.  The lack of  2' OH greatly stabilizes DNA, compared to RNA, because it prevents the intramolecular hydrolysis of phosphate linkages.

    MIT Hypertextbook.

    The base pairs "stack" together like rungs on a ladder, because of favorable interactions between the pi orbitals extending out of the heteroaromatic ring structure of each base.
     

    Molecules and Quizzes
    DNA Base Quiz -- Easiest
    Advanced Nucleotides
    More Advanced DNA Quiz
    Space-filling Model
     B-DNA and A-RNA



    Helical forms of DNA

    The structure of B-form DNA helix was first determined by X-ray analysis of crystalized molecules.
    However, other forms of helix can be stable under certain conditions of salt, pH, and temperature.  In fact, triple-helical forms (triplex DNA, H form) have been found.

    Certain regulatory sites within cells appear to have DNA sequence that takes a non-standard form, sometimes assisted by a protein.

    Moreover, DNA technologists are making use of unusual DNA properties to construct genetic medicines Genetic medicines are pieces of artificial DNA that can hybridize to a region of the genome and turn off transcription of genes, such as a cancer gene.

    Stability of DNA
    DNA is a stable molecule; short pieces of DNA can remain intact in fossils and mummies for thousands of years.

    However, in water solution certain chemical conditions can destabilize DNA.
    For example:
       Acid (low pH) causes detachment of purines from the backbone.
      Alkali (high pH) prevents hydrogen bonding, so the two strands come apart.
    This is one reason that all living things have to regulate their own pH, as studied by Kenyon students in the NSF-funded Bacterial pH Research Lab.

    Supercoiling

    In nearly all living cells, DNA contains negative superturns.  This means it is "underwound," like a piece of yarn that has been twisted in the opposite direction that the multiple strands are wound.  This is called negative supercoiling.  Negative supercoiling may assist replication and transcription of DNA by lowering the energy needed to melt the helix.   See the molecule Topoisomerase.

    In bacteria, negative superturns are maintained by the closed circular structure of the chromosome: It is impossible to unwind the superturns.

    In eukaryotes, negative superturns are maintained by the winding of the DNA helix around histone proteins.



    Problems.

    1.  Early life simulation experiments show that the base adenine would have formed spontaneously out of hydrogen cyanide, on the anaerobic early Earth.  Show how five molecules of HCN can fit together to form exactly one molecule of adenine.

    2.  What kind of charge is on most of the proteins that take up 60% of the chromosome?  Why?

    3.  If chemical analysis of a genome reveals 23% guanine, what are the percentages of the other three bases-- A, T, and C?

    4.  If a certain DNA site needs to come apart easily, for regulatory functions, what kind of base pairs are likely to be favored at that site?

    5.  Suppose an aromatic molecule with lots of pi orbitals could insert between two base pairs like a sandwich.  What would happen as enzymes "read" the DNA information?

    6.  Some Archaea (microbes of the third Kingdom of organisms) living at extremely high temperature and pressure have positively supercoiled DNA.  Why?

    Solutions




    DNA Replication

    DNA replicates semiconservatively.  Replication starts by opening of the DNA helix at a particular sequence called an origin of replication (ori).   Bacteria, even during logarithmic growth, have ONE map position where DNA can originate replication.    Eukaryotes have MANY origins of replication, all of which run concurrently.  In either case, each origin of replication runs bidirectionally, with TWO replicating forks.

    Experiment to show Semiconservative Replication

    Bidirectional semiconservative replication can be demonstrated by observing DNA from cells replicating in the presence of radiolabeled nucleotides.  Both sides of the dividing DNA will be labeled.  What would the above diagrams look like, if the replicating DNA were radiolabeled?

    Molecular Steps of DNA Replication

    Replication of DNA is mediated by enzymes and binding proteins.   One crucial function is to unwind the helix, enabling it to "unzip" exposing bases to pair with the growing strand.  How can the helix be unwound without falling apart?  To see an example, view topoisomerase I.

     DNA replication must be fast and accurate.  To follow the step by step process, click the image:

    The helicase enzyme unwinds DNA, at the origin of replication.  Two replicating forks are created.  This reaction needs ATP.  The exposed single-stranded DNA is protected by single-strand binding proteins (ssb).  Click image for further steps, or see summary:
    Summary of steps of DNA replication

    1.  Helicase enzyme unwinds DNA.  This reaction needs ATP.  At each replicating fork, the exposed single-stranded DNA is protected by single-strand binding proteins (ssb).  Primase enzyme binds, preparing to make RNA primers.

    2.  Primase enzyme makes RNA primer molecules.  Each primer hybridizes (base pairs) with DNA, at the origin of replication.  The 3' OH end will attach new deoxy nucleotides (dNTPs).  The primers will each start a leading strand,

    3.  DNA polymerase III (Pol III) attaches new dNTPs to the 3' OH end of the growing chain of the leading strand, which elongates toward the replicating fork, 5' to 3'.  (For each origin, there are TWO leading strands; why?)  For each NTP, a pyrophosphate (PP) is released, providing the necessary energy.

    4.  More primers hybridize to the opposite strand of DNA.  Pol III starts elongating 5' to 3' but it keeps running into the back of an RNA primer.  This is the lagging strand.  There are TWO lagging strands (why?)

    5.  DNA polymerase I (Pol I) starts at “nicks” in the growing strands.  It edits the strand by removing bases ahead of it (5' end), including RNA and mismatched bases, while elongating the strand "behind" 5' to 3'.  It replaces all RNA nucleotides with dNTPs.

    6.  Ligase seals the phosphate bonds at all “nicks” in the DNA.

    7.  Editing endonucleases excise mismatched nucleotides, replacing with the proper match.  How do they know which is old DNA vs. new DNA?  The old DNA contains methyl groups on some of its cytosine bases.

    8.  Gyrase restores negative superturns in DNA.  ATP is needed.

    9.  Methylases add methyl groups to the new DNA, at the same positions as the original strands.  Now the two daughter helices are indistinguishable from each other, and from the original helix.

    Quiz button: Quiz

    DNA polymerases and other factors involved in the process were initially discovered through protein purification efforts. Key to this technique is liquid chromatography.



    Assumptions of Mendelian Inheritance
    • Constant environment (temperature, nutrition, sunlight etc.)
    • Traits only influenced by known gene loci
    • Genes assort independently -- zero "linkage"

    Mendelian inheritance
    Use Flowers tutorial: p:\data\biology\biol14\tutorial\flowers.exe

    Know these terms:

    • Gene Locus
    • Gene Product
    • Allele
    • Dominant and Recessive alleles; Null alleles
    • Trait
    • Genotype
    • Phenotype
    • Hybrid: Monohybrid; Dihybrid -- Dihybrid Cross -- Dihybrid Cross (local copy)
    • Self cross
    • Test cross or Back cross (when are these the same -- and when not?)
    • Probability rules
    Problems:
    Mendelian Genetics Practice from a course at MIT.
    Virtual Fly : Breed your own fruit flies.
    Other links:
    Horse Genetics: describes interesting horse phenotypes and genotypes, crosses and results
    Online Mendelian Inheritance in Man: a professional physician’s reference on inherited diseases


    Alleles:  What are they?

    An allele is a particular version of a given DNA sequence.  "Allele" is a relative term, implying more than one possible version or copy, like different editions of a book.  Like editions of a book, all existing alleles result from a process of change, either gradual or drastic change.

    Examples:

    Allele 1
            ATCGTTAGATTACAGATTTACCGA
            TAGCAATCTAATGTCTAAATCCGT

    Allele 2
            ATCGTTAGATTCCAGATTTACCGA
            TAGCAATCTAAGGTCTAAATCCGT

    Allele 3
            ATCGTTAGTGTAATGATTTACCGA
            TAGCAATCACATTACTAAATCCGT

    Allele 4
            ATCGTTAG-GATTTACCGA
            TAGCAATC-CTAAATCCGT

    Notice that there can be more than two possible alleles for a given gene locus (but only two at a time, in a given diploid individual.)
    Multiple alleles can mean  many different possible combinations for individuals.  An example of multiple alleles is human blood type -- A or B alleles encode a blood serum protein, whereas the O allele makes no protein ( a null allele.)  Gene loci which confer traits of tissue type may have 20 or more different alleles.

    Natural and "artificial" alleles

    • Natural alleles result from evolution, the process of natural selection.
    • Artificial alleles can be created by molecular genetics.
    • Both natural and artificial alleles can be used by the scientist for breeding purposes.


    Alleles can be observed as DNA polymorphisms, using restriction digest and gel electrophoresis (see Week 7).
    An allele may be linked to an inherited disease--a clue as to the gene locus defective in the disease.
    Which of the  four alleles (M1-M4) is linked to this disease?
    Is the disease likely to be dominant or recessive?

    For a Kenyon student's report on an inherited disease in her family, see Tuberous Sclerosis Complex.



    Alleles confer traits, by expressing gene products, which are either mRNA and protein, or a functional RNA.   But how they determine a "visible trait"  is not simple.  Consider this:

    Problem:

    Fruit fly eyes have two pigments, brown and scarlet.  Normal flies make
    both pigments, but a strain with defective gene B has brown eyes, and a
    strain with defective gene S has scarlet eyes.
    In the wild type, WHICH GENE (B or S) makes which pigment (brown or scarlet)?Solution

    In practice, the most common "new" alleles (arising out of mutation) are often named for a phenotype resulting from the absence of their gene product.  Thus the allele for a gene producing scarlet pigment is named "brown" for the brown eye in the absence of scarlet pigment.

    Consider albinism, or loss of pigmentation, a very common phenotype observed in many species of animals and plants.  Alleles can confer loss of pigmentation in two different ways:
     

    • Recessive albinism.  The allele encodes an enzyme which converts pigment precursors into dark pigment; or a protein required for pigment deposition.  (Humans; mice; penguins.)
    • Dominant color suppression.  The allele encodes a regulatory protein which represses synthesis or deposition of pigment.  (Horse; foxglove)
    Traits are not actually inherited like "beads on a string." Traits result from complex interactions (1) among the products of genes; (2) between genes and regulatory proteins expressed by other genes; (3) between genes and proteins, and environmental factors such as nutrients, temperature, etc.; (4) chance effects during development.

    The reason Mendelian inheritance can be seen to "work" is that in many cases we can hold all the above factors constant, for a given genotype (genes affecting a trait) and a given phenotype (appearance of trait).



    Other ways alleles can work (still at a SINGLE gene locus)
    • Codominance or incomplete dominance.  Codominant alleles each contribute to the phenotype; for example A and B blood type alleles together produce AB blood type.   Incomplete dominance means that the hybrid produces a lesser degree of the dominant phenotype than the purebreeding dominant.
    • Lethality.  If an allele (either dominant or recessive) results in death before birth, a class of progeny will be absent from the offspring.  What ratios will result?

    • Pleiotropy. One allele (or pair of recessive alleles) at one gene locus can result in many diverse effects throughout the body.
    Artificial alleles. Today we can use molecular genetics to create artificial alleles in transgenic animals and plants.  There are two ways to make a transgene, which have  different consequences for inheritance:
    • Allele insertion.  Inject or transfect DNA into a fertilized egg.  The DNA sequence gets taken up somewhere in the genome, but not at the same position as any homologous gene.  The position on the gene map is unpredictable (but fixed once the allele is inserted.)
    • Allele replacement.  A DNA sequence containing a linked selective marker (such as drug resistance) is put into embryonic stem cell culture (ES cells).  The ES cells are put into a blastula, which develops into a chimeric offspring; eventually a pure-breeding line is bred.  In this case, the new allele recombines homologously and replaces an allele at a standard map position.


    Dihybrid Cross  -- or local link.


    Advanced Problem.  Explain how to breed transgenic mice to create a mouse model for sickle-cell anemia.
    Sickle Cell Anemia.

     Pászty et al, Science 1997 October 31; 278: 876-878.

    Sickle-cell disease is caused by a single base pair defect in human beta-globin.

    • Double-recessive genotype--red blood cells sickel under stress.
    • Single-recessive heterozygote--cells sickle only when attacked by malaria parasites.  Prevents malaria.
    To test drug therapies for sickle disease, can we generate a transgenic mouse model for human sickle-cell anemia?

    For the model strain to exhibit sickle-cell pathology, the native mouse genes--all at separate loci--must be defective (null alleles.)  We have a transgenic mouse strain, containing human Hb-alpha, Hb-beta-sickle on a transgene,Tg(Hu), inserted somewhere in the mouse genome (not at the mouse globin genes.)  But the mouse still has its own genes producingalpha  and beta globin.

    To construct this strain, the transgenic strain was intercrossed with a mouse strain heterozygous for null alleles for  alpha and beta globin.

     Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb
     --------     ----------------------       ----------------------
     Tg(Hu) Mouse-alpha-Hb     Mouse-beta-Hb

                                X

        --         Mouse-alpha-Hb     Mouse-beta-Hb
     --------     --------------------       --------------------
        --            ----                            ----
     

    How many generations would you need to cross?
    What proportion of mice would show the desired phenotype of blood with entirely human globins?
     

     Tg(Hu)               ----                         ----
     ------------     ------------------     -------------------
     Tg(Hu)          ----                         ----

    What would the researchers have to do to create a similar model with exclusively normal human blood?  Why would this be important in order to use the model?  (For further interest, read Ryan et al, 1997.)


    >> Back to Syllabus >>
    Top